| ID# | Plasmid name | Description | Depositor |
|---|---|---|---|
| 370 | Δ(1-75;119-579)-golvesin(C)-GFP | Core fragment of golvesin with C-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 502 | (Myc)2-apm1 | KpnI-myc-BglII-myc-SacI-BamHI-apm1-XhoI-NsiI-myc-stop (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 503 | (Myc)2-apm2 | KpnI-myc-BglII-myc-SacI-BamHI-apm2-stop-XhoI-NsiI... (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 504 | (Myc)2-apm3 | KpnI-myc-BglII-myc-SacI-BamHI-apm3-xhoI-NsiI-myc-stop (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 505 | (Myc)2-apm4 | KpnI-myc-BglII-myc-SacI-BamHI-apm4-stop-XhoI-NsiI... (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 506 | (Myc)2-delta | KpnI-myc-BglII-myc-SacI-BamHI-delta-xhoI-nsiI-myc-stop (in pDXD-3C) No visible structure in IFs. | Nelly Bennett |
| 501 | (Myc)2-VAMP7 | KpnI-myc-BglII-myc-sacI-BamHI-VAMP7-XhoI-NsiI-myc-stop (in pDXD-3C) In IFs, 9E10 labels endocytic compartments and also in some cells the plasma membrane. | Nelly Bennett |
| 1 | 339-3 (mRFPmars in pBsrH) | Synthetic brilliant red fluorescent protein. The last amino acid that belongs to mRFPmars sequence in the 339-3 vector is A. G and S correspond to the BamHI restriction site, E and F to the EcoRI restriction site. There is no His-tag encoded by 339-3 as this is made for expression in Dictyostelium. The sequence you insert into the MCS has to end with a stop codon as there is no stop present in the sequence. | Annette Muller-Taubenberger |
| 385 | ACG-KO | Knockout plasmid for acgA | Karin Weening (Pauline Schaap) |
| 314 | Act 15 ACG | Pauline Schaap | |
| 322 | Act 15 ACG-Y | Pauline Schaap | |
| 514 | act15::[rasC/GFP] | GFP-rasC expression construct under control of the actin15 promoter. | P. Bolourani (G. Weeks) |
| 107 | amiB-KO (p12-3NdeI) | Recapitulation of the R12-3 amiB- REMI mutant (aggregation-minus B) | Yukako Asano (Kazuo Sutoh) |
| 106 | amiB-KO (p82ClaI) | Recapitulation of the R8-2 amiB- REMI mutant (aggregation-minus B) | Yukako Asano (Kazuo Sutoh) |
| 460 | arpB-KO | Knockout construct for arpB (blasticidin cassette from pRHI148 was excised as a ClaI fragment and ligated into the BstBI site of arpB) | |
| 202 | atgN-KO | atgN knockout construct containing bsr cassette. | Turgay Tekinay |
| 793 | AX4-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-AX4 and tgrC1-AX4 alleles, driven by AX4 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos |
| 321 | BS15 | Pauline Schaap | |
| 14 | calA | calA cDNA in PET15b (Dicty calmodulin I) | Barrie Coukell |
| 306 | calreticulin pHluorin | ER pH-sensor | Harry MacWilliams |
| 124 | carB::lacZ | carB-lacZ expression construct | Karl Saxe |
| 56 | cbpA-KO | cbpA (calcium-binding protein 1) gene disruption construct. | Barrie Coukell |
| 15 | cbpJ | cbpJ cDNA in PET15b (CbpJ protein) calcium-binding protein | Barrie Coukell |
| 68 | CRAC-GFP (pWf1) | Full-length cDNA of CRAC was cloned upstream of the start codon of GFP. The resulting CRAC-GFP construct was inserted in the constitutive expression vector B18. | Peter Devreotes |
| 158 | CS4 5.03 | Blasticidin cassette is loxed; plasmid can be used to replace the endogenous NSFA gene with the ts variant, which exists in HM1067. Plasmid is similar to the unloxed version used to generate NSFA2 (Pmid 12183371; d7379). | Mark Bretscher |
| 57 | cupB-AS | cupB (Ca2+/Calcineurin-regulated cup gene) antisense construct. | Barrie Coukell |
| 315 | dimB-KO | dimB knockout vector. | Gad Shaulsky |
| 230 | DIV1 | remi plasmid (not yet available) | Bill Loomis |
| 228 | DIV2 | Remi plasmid (DIV2 is the same as DIV1 shown below, except it contains the pyr5-6-containing ClaI fragment in the opposite orientation). | Bill Loomis |
| 239 | DIV5 | remi plasmid for uracil selection (not yet available) | Bill Loomis |
| 229 | DIV6 | Remi plasmid. The PstI-SacI pyr5-6 fragment from DIV1 was ligated into PstI/SacI digested pGEM-5Zf(+) (Promega). | Bill Loomis |
| 511 | dmpA::bsr | Remi rescued plasmid from rasC-/dmpA- cells (dmpA knockout vector). | P. Bolourani (G. Weeks) |
| 89 | dng-KI | Dominant-negative knock-in construct for Gγ (Dicty Gγ without the C-terminal four amino acids). Same as GγΔ? | Peter Devreotes |
| 259 | DNG1-GFP | DNG1-GFP vector | Yasuo Maeda |
| 257 | DNG1-KO | DNG1 knockout vector | Yasuo Maeda |
| 258 | DNG1-OE | DNG1 overexpression vector | Yasuo Maeda |
| 280 | dpoA KO construct | dpoA knockout vector (plasmid rescued with ClaI from REMI mutant HAD172). | Adrian Harwood |
| 492 | DsRed | DsRed expression vector pDG75 (expressing Discosoma sp. Red Fluorescent protein); transformed bacteria are red when grown in LB with ampicillin (75 ?g/ml) and 1 mM IPTG. | David Knecht |
| 46 | EcmA-Gal | EcmA PCR'd promoter fragments inserted into BamHI site of A15deltaBam-gal. 3'end, Bam/BglII at +250 (just upstream of EcmA-ATG). 5'end, BamHI site at variable points. (prestalk marker) | Jeff Williams |
| 344 | ecmA/myc-fbxA | Myc-tagged FbxA under the control of the prestalk ecmA promoter. | Jakob Franke |
| 51 | EcmB-Gal | Galactosidase fusion expression vector (prestalk marker) | Jeff Williams |
| 47 | EcmO-Gal | EcmA PCR'd promoter fragments inserted into BamHI site of A15deltaBam-gal. 5' end, Bam/BglII at -1694. 5' end, BamHI site at variable points. (5' junction of available promoter) | Jeff Williams |
| 356 | EXP4(+) | Integrating expression vector based on pATSP. | Karin Weening (Pauline Schaap) |
| 357 | EXP5(+) | Integrating expression vector derived from EXP4(+) by removal of the HindIII and XbaI sites, and replacement of the mcs. | Karin Weening (Pauline Schaap) |
| 55 | EXPpatA-AS | patB (Ca2+-ATPase PAT1) antisense construct | Barrie Coukell |
| 10 | EZTN:tetR-bsR | Vector containing a transposable bsR cassette. | Tomo Abe |
| 104 | FadA-KO | fadA knock-out vector (Bsr cassette inserted in the HindIII site) | Tamao Saito |
| 105 | FadB-KO | fadB knockout vector with the Bsr cassette inserted in the BglII site. | Tamao Saito |
| 346 | fbxA/gfp-neo | Plasmid that expresses GFP under the control of the fbxA promoter (in a pTX-GFP background). | Jakob Franke |
| 332 | fbxA/myc-fbxA | Myc-tagged FbxA under the control of the fbxA promoter in a pDXA background. | Jakob Franke |
| 302 | Gα2-CFP | Reporter construct (CFP inserted into the helical domain of Gα2 in a location optimal for FRET). | Jane Borleis (Devreotes) |
| 99 | Gβ-YFP | Reporter construct (YFP fused to NH2-terminal of Gβ). The gene encoding the full-length YFP was fused to the NH2-terminus of the Gβ gene. A BglII restriction site was added at the junction that consisted of two additional amino acids, arginine and serine. This β-YFP fusion protein was cloned into the CV5 vector. CV5 was derived from p88 by addition of an actin 15 expression cassette from pMC34. | Tian Jin |
| 64 | Gγ-YFP | Gγ-YFP construct (unpublished) | Peter Devreotes |
| 371 | GFP-(N)-Δ(1-75)-golvesinGFP | Golvesin lacking the N-terminal 75 amino acids with C-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 373 | GFP-(N)-Δ(559-579)-golvesin | Golvesin with C-terminal deletion and N-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 374 | GFP-(N)-golvesin-(L9A,L10A) | Full-length golvesin lacking the dileucine motif, with N-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 108 | GFP-Arp2/pBIG(G418) | The arp2 fragment was subloned into the pBIG plasmid downstream of the actin15 promoter, the GFP coding sequence, and a Gly-Pro-Gly linker sequence, and upstream of the actin15 terminator. | Yukako Asano (Taro Uyeda) |
| 98 | GFP-Gβ | Reporter construct (GFP fused to NH2-terminus of Gβ subunit). The coding region of GFP-Gβ fusion protein was cloned into pMC34, an extrachromosomal expression vector. | Tian Jin |
| 497 | GFP-Syntaxin8 | KpnI-GFP-SacI-BamHI-Syntaxin8-XhoI-NsiI-myc-stop (in pDXD-3C) Decorates the bladders and tubular network of the contractile vacuole. | Nelly Bennett |
| 498 | GFP-VAMP7-stop | KpnI-GFP-SacI-BamHI-VAMP7-stop-XhoI-NsiI-myc-stop (in pDXD-3C) Decorates the endocytic compartments and sometimes the contractile vacuole bladders. The plasma membrane is also decorated in about 10% of the cells. | Nelly Bennett |
| 499 | GFP-VAMP7[L35A]-stop | KpnI-GFP-SacI-BamHI-VAMP7[L35A]-stop-XhoI-NsiI-myc-stop (in pDXD-3C) Decorates the endocytic compartments and sometimes the contractile vacuole bladders. The plasma membrane is decorated in about 70% of the cells. | Nelly Bennett |
| 369 | Golvesin(C)-GFP | Golvesin with C-terminal GFP tag | U. Mintert (G. Gerisch) |
| 372 | Golvesin(N)-GFP | Golvesin with N-terminal GFP tag. | U. Mintert (G. Gerisch) |
| 223 | gp130-ura | knockout plasmid for gp130 (uracil cassette in genomic gp130) | Cathy Chia |
| 442 | iplA(ins) | iplA knockout vector. | David Lam (Pierre Golstein) |
| 405 | K-neo | Dd PK2 protein kinase over-expression vector. | Christophe Anjard |
| 406 | Kdel-neo | Mutated Dd PK2 protein kinase over-expression vector. (K-neo cut with KpnI, blunt-ended with T4-polymerase, and religated) | |
| 316 | lim2- | Kanamycin-resistant limB-knockout vector (in pCR-BluntII-TOPO) with hygromycin-resistance cassette. | Gerti Weijer |
| 246 | LST8-KO | LST8 knockout vector | Rick Firtel |
| 247 | LST8-OE | LST8 overexpression vector | Rick Firtel |
| 292 | lvsB-KO | Knockout vector with bsR cassette for lvsB gene | Arturo De Lozanne |
| 293 | lvsC-KO | Knockout vector with bsR cassette for lvsC gene | Arturo De Lozanne |
| 294 | lvsD-KO | Knockout vector with bsR cassette for lvsD gene | Arturo De Lozanne |
| 295 | lvsE-KO | Knockout vector with bsR cassette for lvsE gene | Arturo De Lozanne |
| 296 | lvsF-KO | Knockout vector with bsR cassette for lvsF gene | Arturo De Lozanne |
| 474 | mars-ABD120 | Vector with a bsR-resistance cassette, expressing a fusion of the actin-binding domain of ABD120 (filamin) and RFP. The plasmid was originally constructed by Annette Mueller-Taubenberger. The sequence was repaired by Dave Knecht (Y218N) | David Knecht (Annette Mueller-Taubenberger) |
| 264 | MB35-M2 (tetON driver) | Both tetON and tetOFF systems exist for Dicty. The tetOFF system was pioneered by Dingermann and colleagues, but the most frequently used vectors are those constructed by Blaauw et al., Gene 252:71-82, 2000. The Dicty tetON system is derived from yeast vectors described in Urlinger et al., PNAS 97:7963-8, 2000; the rtTa-M2 element from ? was recloned into the Blaauw vector MB35 by Adriano Ceccarelli, and students in my lab have shown that the performance of this tetON system in Dicty (induction factor, response time) is similar to that of the tetOFF system. Both the original tetOFF MB35 and its tetON version are neo vectors. In practice one needs a Dicty strain carrying one or the other of these, which one overtransforms with a second, blasticidin vector (Blauuw et al. MB38) carrying the gene of interest. Once one has cloned one's gene into MB38, it can be overtransformed into both tetON and tetOFF strains. Both MB35 and MB38 are in the stock center, as are cells containing MB35. The tetON version of MB35 will go to the stock center today. | Harry MacWilliams |
| 367 | MF1 | cudA knockout vector obtained from original REMI mutant (using pRHI30) by EcoRI digestion and religation. | Masashi Fukusawa |
| 368 | MF2 | cudA knockout vector containing an internal deletion and bsr cassette. | Masashi Fukusawa |
| 462 | mrrA:lacZ | Complete mrrA upstream promoter region fused to lacZ. | Susan Ross (Jeff Williams) |
| 317 | Myc10 | Pauline Schaap | |
| 13 | ncsA | ncsA cDNA in PET15b (NcsA protein) | Barrie Coukell |
| 16 | ncsA-KO vector | ncsA cDNA clone (SSL268) in pBluescript KS - with the blasticidin S cassette from pBsR519 cloned into the ClaI site near the middle of the coding region. | Barrie Coukell |
| 365 | Nramp1-KO vector | Nramp1 knockout vector | Salvo Bozzaro |
| 224 | p155d1 | 7268-bp Csp451 fragment of Ddp1 in p60. | Carole Parent |
| 218 | p240Cla | erkB knockout vector (2.1-kb and 1.7-kb genomic fragments flanking the remi plasmid DIV6) | Bill Loomis |
| 225 | p60 | Dictyostelium expression vector: 2.3-kb SalI-EcoRI fragment (neoR cassette) of pB10S subcloned into pGEM3Z. | |
| 43 | p6B (CAR1) | Partial cAR1 cDNA in pBlue Script. | Peter Devreotes |
| 86 | pA15 | Peter Devreotes | |
| 631 | pA15-500-myc | Plasmid to drive the overexpression of SOD using the actin 15 promoter; contains C-terminal myc tag. | Catherine Pears |
| 279 | pA15-BSR-aarA-KO | aardvark knockout vector generated by replacing a 600-base-pair ClaI/EcoRI fragment in the aar cDNA with a 1.4-kilobase (kb) ClaI/EcoRI fragment containing a blasticidin-resistance gene expressed from an actin-15 promoter | Adrian Harwood |
| 191 | pA15-PsiA(ORF) | psiA rescue vector, in Exp4(+), under the control of the actin 15 promoter. | Takefumi Kawata |
| 48 | pA15-Rm | (pActRsub-AEBE) Two glycine->glutamic acid mutations in the regulatory subunit of PKA. Overexpression results in inhibition of the catalytic subunit in the presence of cAMP. | Jeff Williams |
| 351 | pA15/aequorin | plasmid containing the aequorin gene under the control of the act15 promoter, G418 resistant; constructed by Robert Insall | Harry MacWilliams |
| 342 | pA15/CFP-Apg1 | Fusion construct of CFP and DdApg1 under the control of the actin 15 promoter (in pDXA-HC). | Grant Otto |
| 339 | pA15/GFP-Apg1 | GFP-Apg1 fusion construct under the control of the actin 15 promoter (in pDXA-HC) | Grant Otto |
| 341 | pA15/GFP-Apg8 | GFP-DdApg8 fusion construct under the control of the actin 15 promoter (in pTX-GFP). | Grant Otto |
| 330 | pA15/myc-fbxa | Myc-tagged FbxA in pDXA background. | Jakob Franke |
| 384 | pA15/paxB-GFP(S65T) | paxillin-GFP expression vector; blasticidin resistance marker | Gerti Weijer |
| 300 | pA15/pHluorin | Cytosolic pH-sensor | Harry MacWilliams |
| 340 | pA15/RFP-Apg8 | RFP-DdApg8 fusion construct under the control of the actin 15 promoter (in RFPmars). Ddatg8 was obtained by PCR with the primers GGGGATCCGTTCATGTATCAA and GGGGATCCTTATAAATCACTA and cloned into the BamHI restriction site of the plasmid RFPmars. | Grant Otto |
| 569 | pA15BSR-pic20HmcsF | act15:BSR vector with the pic20H multiple cloning site inserted in the forward orientation at the 3' end of the act8 terminator | Harry MacWilliams |
| 570 | pA15BSR-pic20HmcsR | act15:BSR vector with the pic20H multiple cloning site inserted in the reverse orientation at the 3' end of the act8 terminator | Harry MacWilliams |
| 311 | pA15lagC | ||
| 468 | pA15TX | ||
| 469 | pA15XPT1 | ||
| 470 | pA6NPTII | ||
| 461 | pACA-KO | Two DNA fragments were amplified using genomic DNA as template. One of the fragments corresponds to the region upstream of the aca open reading frame. The other one corresponds to the region encoding the middle part of the aca open reading frame. The blasticidin cassette was also amplified by PCR and inserted in the middle of both cyclase fragments using the metod of Kuwayama et al. (Pmid 11788728; d7349), and cloned into pCR-BluntII-TOPO. | Satomi Matsuoka (M. Ueda) |
| 87 | pACA.URA | ACA knockout construct | Peter Devreotes |
| 81 | pAcbA-BSR-KO | acbA knockout vector | Bill Loomis |
| 334 | pAcgA-KO-Hygro | knock out vector for the acgA gene with hygromycin resistance. This plasmid was made by Marcel Meima in P. Schapp's lab. It has not been published although an ACG knockout was made with it. | Pauline Schaap |
| 265 | pAct15-Gal | Galactosidase expression vector. The XbaI/BglII fragment of the actin 15 promoter was cloned into pdDGal17. | Adrian Harwood |
| 117 | pAct15-Gal | Galactosidase expression vector with actin 15 promoter. The XbaI/BglII fragment of the actin 15 promoter was cloned into pdDGal17. | David Knecht |
| 718 | pAct15/SodA-myc | C-terminal myc-tag/sodA cloned into pAct15-Gal | Catherine Pears |
| 271 | pActin15-GskA | gskA expression vector (actin15::gskA) made by subcloning the gskA cDNA into pDXA-3H (gskA contains C-terminal 6xHistidine tag). | Adrian Harwood |
| 274 | pActin15-Rc | actin15::PKA-Rsubunit (Rc mutant does bind C subunit = control) expression vector. | Adrian Harwood |
| 273 | pActin15-Rm | actin15::PKA-Rsubunit (Rm mutant) expression vector. | Adrian Harwood |
| 272 | pActin15-Rsub1 | actin15::PKA-Rsubunit (wild type) expression vector containing the actin6-neoR cassette. | Adrian Harwood |
| 283 | pActin15StatAcidpep | actin15::StatA containing Ser-Asp GSK3 peptide specific substrate | Adrian Harwood |
| 282 | pActin15StatAlapep | actin15::StatA containing Ser-Ala GSK3 peptide specific substrate | Adrian Harwood |
| 281 | pActin15StatWTpep | actin15::StatA containing WT GSK3 peptide specific substrate | Adrian Harwood |
| 59 | pAK2 | carB-KO construct (car2-::thy) | Karl Saxe |
| 221 | pAmpA/lacZ | ampA promoter-lacZ fusion construct | Daphne Blumberg |
| 62 | pATψ-BsrR-Rev | Targeting vector for the psiA gene | Takefumi Kawata |
| 312 | pax1- | pax1 knockout vector (in pBLuescript-SKII) containing bsr cassette. | Gerti Weijer |
| 798 | pAX4-tgrB1/tgrC1-bsR | tgrB1/tgrC1 Merodiploid plasmid with tgrB1-AX4 and tgrC1-AX4 alleles, driven by AX4 promoter. Used to insert an extra set of tgrB1/tgrC1 alleles randomly in the genome. Bacterial selection: amp; dicty selection: bsR; parent pGEM3 | Rocio Benabentos |
| 226 | pB10S | Not available yet. Dictyostelium expression vector containing neoR cassette (actin 6 promoter, Tn5 neomycin resistance gene, actin 8 terminator (in reverse)). | |
| 291 | pB10TP4 | Not available. Same as pB10TP2 except for a modification in the polylinker (JG Williams, pers. commun.) | |
| 25 | pB18 | Integrating expression vector. containing the actin6 neo cassette. | Peter Devreotes |
| 487 | pBC18 | Chimeric protein, with the extracellular portion of the contact site A protein fused to the transmembrane domain of the integral protein P29F8 and to the cytoplasmic sequence KTRVSQNSG, in the expression vector pDCEV4. | Francois Letourneur |
| 121 | pBIG | Autonomous replicating extrachromosomal expression vector with G418 castte. | Tom Egelhoff |
| 381 | pBIG-GFP-myo | Expresses mhcA with GFP fused at N-terminus, driven by actin 15 promoter. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 379 | pBIGALA | Expresses mhcA fused to actin 15 promoter, carrying "3xALA" mutation of threonines 1823, 1833, and 2029. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 380 | pBIGASP | Expresses mhcA fused to actin 15 promoter, carrying "3xASP" mutation of threonines 1823, 1833, and 2029. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 386 | pBORP | Expression vector containing neoR cassette. | Rex Chisholm |
| 42 | pBS-ACA | partial ACA cDNA (adenylyl cyclase) in pBlueScript | Peter Devreotes |
| 389 | pBS18/car2 | Karl Saxe | |
| 85 | pBSA15 | A15-neo cassette cloned in pBluescript in its BamHI-EcoRI site. | Peter Devreotes |
| 407 | pBSEGE | The plasmid pBSEGE was rescued from egeA- genomic DNA by circularization of a HindIII fragment. | |
| 471 | pBSR-GFPABD120 | Vector containing a blasticidin resistance cassette, expressing a fusion of GFP and the actin-binding domain of ABD120 (filamin). | David Knecht |
| 208 | pBsr-Nsi-MHCKD-KO | mhkD knockout vector | Tom Egelhoff |
| 601 | pBSR-tgrB1-KO | tgrB1 knock-out plasmid | Rocio Benabentos (Shaulsky Lab) |
| 32 | pBSR1 | REMI plasmid with blasticidin cassette, with the sequence CAACAAGATCTAGAATTAG changed to CAACAAGATCCAGAATTAG to eliminate the internal BglII and XbaI sites to make it more convenient for REMI usage. | Gadi Shaulsky |
| 33 | pBSR3 | REMI plasmid containing blasticidin cassette (SmaI and ApaI sites were introduced in pBSR1 flanking the BamHI site) | Gadi Shaulsky |
| 37 | pBsR479 | ampicillin-resistant vector with bsR cassette | Frantisek Puta |
| 38 | pBsR503 | Kanamycin-resistant vector with bsR cassette | Frantisek Puta |
| 36 | pBsR519 | ampicillin-resistant vector with bsR cassette | Frantisek Puta |
| 414 | pBsrH | Expression vector derived from pDEXH by replacing the neoR cassette with the bsR cassette. | Markus Maniak |
| 70 | pCAR1-B18 | cAR1 over-expression vector | Peter Devreotes |
| 93 | pCAR1-GFP | Jane Borleis (Peter Devreotes) | |
| 28 | pCAR2-B18 | cAR2 over-expression vector | Peter Devreotes |
| 29 | pCAR3-B18 | cAR3 over-expression vector | Peter Devreotes |
| 73 | pCAR3-KO-ura | Not sure whether it is the 5cAR3ura vector described in Johnson et al. (1993) (d4673) | Peter Devreotes |
| 34 | pCFC5 | Expression vector containing N-terminal epitope tag (T7 antigen) | Gene Katz |
| 35 | pCFC6 | Expression vector containing N-terminal epitope tag (T7 antigen) | Jakob Franke |
| 588 | pchtC | Inserted PCR fragment containing regions from the chtC gene (around the insertion site) from pLAS5 (using SP6 and T7 primers) into the ClaI site of the pLPBLP plasmid. Parental strain: pLPBLP (pBluescript II KS+ backbone) | Anupama Khare (Gad Shaulsky's lab) |
| 17 | pCnxA-GFP(S65T) | calnexin-S65T-GFP in pDEXRH (G418) | Annette Muller-Taubenberger |
| 583 | pCotB/GFP(S65T) | GFP(S65T) expressed under the control of the cotB promoter | Danny Fuller (Loomis) |
| 352 | pCotB/LacZ | Reporter construct expressing β-galactosidase under control of the prespore cotB promoter | Bill Loomis |
| 24 | pCP33 | Extrachromosomal vector with neo cassette. Based on p155d1, with multiple cloning site added. | Peter Devreotes |
| 227 | pCP43 | ACA (adenylyl cyclase) expression vector: ACA cDNA with act15 promoter cloned into ApaI/BstXI sites of pCP43. The ACA cDNA came with its own terminator (800-bp 3'-untranslated region) | Carole Parent |
| 232 | pCT7 | dmtA promoter driving gfp | Rob Kay |
| 23 | pCV5 | CV5 is derived from p88 by the addition of an actin 15 expression cassette from pMC34. | Peter Devreotes |
| 270 | pD19-lacZ | LacZ (β-galactosidase) expression under control of the prespore promoter D19 (Psa or pspA). | Adrian Harwood |
| 622 | pDBsr2a-6xMyc-TAP | Wolfgang Nellen | |
| 621 | pDBsr2a-cTAP | Wolfgang Nellen | |
| 620 | pDBsr2a-nTAP | Wolfgang Nellen | |
| 623 | pDBsr2a-TAP-6xMyc | Wolfgang Nellen | |
| 626 | pDBsrXP-3xHA | Wolfgang Nellen | |
| 627 | pDBsrXP-6xMyc | Wolfgang Nellen | |
| 629 | pDBsrXP-GFP | Wolfgang Nellen | |
| 630 | pDBsrXP-mRFPmars | Wolfgang Nellen | |
| 605 | pDchtC | Knockout vector to delete almost the entire chtC gene. Linearize with BamHI and use for homologous recombination. Used to create CCR2 / DBS0307850. | Anupama Khare (Gad Shaulsky) |
| 185 | pDd31P4 Neo | spiA promoter in pDdGal16 | Del Richardson (via Stefan Pukatzki) |
| 39 | pDd56 | EcmB (ST310) cDNA clone isolated as a prestalk-enriched, DIF-inducible mRNA (2.4-kb cDNA cloned in the PstI site of pUC8). DDB0216219 | Jeff Williams |
| 40 | pDd63 | EcmA (ST430) cDNA clone isolated as a prestalk-enriched, DIF-inducible mRNA (2.3-kb cDNA cloned in the PstI site of pUC8); DDB0220137 | Jeff Williams |
| 739 | pDDB_G0267380-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 724 | pDDB_G0267692-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 741 | pDDB_G0267938-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 664 | pDDB_G0268222-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 678 | pDDB_G0268222-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 640 | pDDB_G0268888-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 694 | pDDB_G0269150-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 744 | pDDB_G0269288-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 690 | pDDB_G0269306-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 641 | pDDB_G0269760-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 688 | pDDB_G0269834-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 674 | pDDB_G0269834-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 746 | pDDB_G0270470-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 697 | pDDB_G0270586-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 743 | pDDB_G0270652-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 687 | pDDB_G0270666-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 673 | pDDB_G0270666-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 747 | pDDB_G0270724-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 642 | pDDB_G0270786-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 699 | pDDB_G0271808-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 706 | pDDB_G0272670-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 643 | pDDB_G0272885-DDB_G0274011-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 705 | pDDB_G0272965-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 701 | pDDB_G0273017-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 742 | pDDB_G0273059-DDB_G0273737-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 644 | pDDB_G0273131-DDB_G0273639-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 712 | pDDB_G0273315-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 703 | pDDB_G0274267-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 645 | pDDB_G0274689-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 710 | pDDB_G0275241-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 646 | pDDB_G0275467-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 708 | pDDB_G0275745-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 722 | pDDB_G0276269-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 647 | pDDB_G0277103-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 700 | pDDB_G0277245-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 704 | pDDB_G0277431-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 728 | pDDB_G0277487-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 648 | pDDB_G0277545-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 692 | pDDB_G0277951-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 662 | pDDB_G0278171-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 676 | pDDB_G0278171-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 732 | pDDB_G0278235-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 684 | pDDB_G0278353-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 670 | pDDB_G0278353-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 715 | pDDB_G0278457-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 669 | pDDB_G0278663-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 668 | pDDB_G0278663-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 683 | pDDB_G0278663-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 682 | pDDB_G0278663-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 749 | pDDB_G0278945-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 671 | pDDB_G0279135-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 685 | pDDB_G0279135-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 727 | pDDB_G0279355-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 693 | pDDB_G0279783-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 649 | pDDB_G0280375-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 713 | pDDB_G0280943-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 650 | pDDB_G0281057-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 651 | pDDB_G0281769-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 652 | pDDB_G0281975-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 672 | pDDB_G0282113-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 686 | pDDB_G0282113-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 653 | pDDB_G0282491-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 698 | pDDB_G0283535-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 680 | pDDB_G0284159-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 666 | pDDB_G0284159-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 711 | pDDB_G0284847-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 725 | pDDB_G0285747-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 748 | pDDB_G0285747-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 736 | pDDB_G0285859-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 677 | pDDB_G0285859-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 663 | pDDB_G0285859-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 729 | pDDB_G0286031-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 695 | pDDB_G0286363-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 654 | pDDB_G0286967-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 675 | pDDB_G0287421_RTE-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 689 | pDDB_G0287421_RTE-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 691 | pDDB_G0287515-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 696 | pDDB_G0287659-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 730 | pDDB_G0287877-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 655 | pDDB_G0287895/DDB_G0287897-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 731 | pDDB_G0288007-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 656 | pDDB_G0288419-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 657 | pDDB_G0288419-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 709 | pDDB_G0289231-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 733 | pDDB_G0289503-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 658 | pDDB_G0289777-DDB_G0289805-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 716 | pDDB_G0289791-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 726 | pDDB_G0290347-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 734 | pDDB_G0290481-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 702 | pDDB_G0290535-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 735 | pDDB_G0291263-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 723 | pDDB_G0291350-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 679 | pDDB_G0291464-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 665 | pDDB_G0291464-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 745 | pDDB_G0291800-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 717 | pDDB_G0291824-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 714 | pDDB_G0292168-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 681 | pDDB_G0293662-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 667 | pDDB_G0293662-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 659 | pDDB_G0293982-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 740 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 738 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 737 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 707 | pDDB_G0295493-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 660 | pDDB_G0305538-REMI | bacterial selection: amp; dicty selection: bsR; parent pBBC | Christopher Quang Dung Dinh/Adam Kuspa |
| 266 | pDdGal-15 (H+) | Galactosidase vector with HindIII site after terminator. | Adrian Harwood |
| 267 | pDdGal-16 (H-) | Galactosidase vector without HindIII site after terminator. | Adrian Harwood |
| 268 | pDdGal-17 (H+) | Galactosidase vector with HindIII site after terminator. | Adrian Harwood |
| 269 | pDdGal-17 (H-) | Galactosidase vector without HindIII site after terminator. | Adrian Harwood |
| 217 | pDE-0.9 | Coding region of the extracellular phosphodiesterase. (0.9-kb BstBI-EcoRI fragment, from cDNA clone p-1.2, subcloned in pUC19 digested with AccI and EcoRI) | Jakob Franke |
| 119 | pDE102 | Vector containing hygromycin cassette | Tom Egelhoff |
| 187 | pDE104 | integrative vector with hygromycin selection under the control of the act15 promoter and act15 terminator; note that hygromycin selection does not works reproducibly | Tom Egelhoff |
| 120 | pDE109 | Non-autonomous extrachromosomal expression vector with hygromycin selection cassette. | Tom Egelhoff |
| 604 | pDEX-Cre-hygR | Dictyostelium Cre expression vector with a hygromycin resistance cassette. | Anupama Khare (Gad Shaulsky) |
| 8 | pDEX-NLS-cre | Dictyostelium Cre expression vector for the generation of multiple gene disruptions | Jan Faix |
| 409 | pDEXH | Expression vector based on pIC20R. Expression of inserted cDNAs is driven by an actin 15 promoter and terminated by an actin 8 tandem terminator. Bacterial Tn5 phosphotransferase under the control of the actin 6 promoter allows selection of Dictyostelium transformants with G418. | Jan Faix |
| 366 | pDEXH-GFP-PiaAHSB1 | GFP-PIA expression vector (temperature sensitive) | Salvo Bozzaro |
| 290 | pDEXH-GFP-PiaAWT | GFP-Pianissimo expression vector. piaA | Salvatore Bozzaro |
| 410 | pDEXRH | Modified version of pDEXH. Expression vector based on pIC20R. Expression of inserted cDNAs is driven by an actin 15 promoter and terminated by an actin 8 tandem terminator. Bacterial Tn5 under the control of the actin 6 promoter allows selection of Dictyostelium transformants with G418. | Jan Faix |
| 101 | pDF15 | myosin heavy chain kinase gene replacement vector containing the Thy1 gene | Tom Egelhoff |
| 473 | pDH-GFPABD120 | Vector containing a hygromycin-resistance cassette expressing a fusion of GFP and the actin-binding domain of ABD120 (filamin). | David Knecht |
| 355 | pDH29 | Remi plasmid for ura selection (derived from pJB1) | Dale Hereld |
| 299 | pDimA-KO | dimA knockout construct | Chris Thompson |
| 562 | pDM131 | Plasmid containing N-terminal mRFPmars tag. | Douwe Veltman |
| 563 | pDM193 | Plasmid containing N-terminal GST tag. | Douwe Veltman |
| 564 | pDM229 | Plasmid containing N-terminal TAP tag. | Douwe Veltman |
| 565 | pDM276 | Plasmid containing C-terminal TAP tag. | Douwe Veltman |
| 532 | pDM304 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. | Douwe Veltman |
| 516 | pDM309 | Extrachromosomal, inducible expression vector. Transactivator tTA. MCS BglII/SpeI. G418 resistance. | Douwe Veltman |
| 517 | pDM310 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. | Douwe Veltman |
| 567 | pDM312 | Plasmid containing C-terminal mRFPmars tag. | Douwe Veltman |
| 566 | pDM313 | Plasmid containing C-terminal GFP tag. | Douwe Veltman |
| 537 | pDM314 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal GST tag. | Douwe Veltman |
| 539 | pDM315 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal TAP tag. | Douwe Veltman |
| 535 | pDM317 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal GFP tag. - Douwe Veltman will send a new version of the plasmid (April 2009) | Douwe Veltman |
| 536 | pDM318 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 538 | pDM320 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. N-terminal FLAG tag. | Douwe Veltman |
| 542 | pDM321 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. C-terminal TAP tag. | Douwe Veltman |
| 540 | pDM323 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. C-terminal GFP tag. | Douwe Veltman |
| 541 | pDM324 | Extrachromosomal expression vector. MCS BglII/SpeI. G418 resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 533 | pDM326 | Extrachromosomal expression vector. MCS BglII/SpeI. Blasticidin resistance. | Douwe Veltman |
| 552 | pDM327 | NgoMIV shuttle vector. MCS BglII/SpeI. N-terminal GFP tag. | Douwe Veltman |
| 553 | pDM328 | NgoMIV shuttle vector. MCS BglII/SpeI. N-terminal mRFPmars tag. | Douwe Veltman |
| 555 | pDM329 | NgoMIV shuttle vector. MCS BglII/SpeI. C-terminal GFP tag. | Douwe Veltman |
| 554 | pDM330 | NgoMIV shuttle vector. MCS BglII/SpeI. C-terminal mRFPmars tag. | Douwe Veltman |
| 520 | pDM331 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal GST tag. | Douwe Veltman |
| 521 | pDM332 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal TAP tag. | Douwe Veltman |
| 522 | pDM334 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal GFP tag. | Douwe Veltman |
| 523 | pDM335 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 524 | pDM338 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. C-terminal TAP tag. | Douwe Veltman |
| 525 | pDM340 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. C-terminal GFP tag. | Douwe Veltman |
| 526 | pDM341 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. G418 resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 551 | pDM344 | NgoMIV shuttle vector. MCS BglII/SpeI. | Douwe Veltman |
| 568 | pDM347 | Plasmid containing Gateway conversion cassette. | Douwe Veltman |
| 543 | pDM351 | Extrachromosomal expression vector. Gateway. G418 resistance. N-terminal GFP tag. | Douwe Veltman |
| 544 | pDM352 | Extrachromosomal expression vector. Gateway. G418 resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 546 | pDM353 | Extrachromosomal expression vector. Gateway. G418 resistance. C-terminal GFP tag. | Douwe Veltman |
| 545 | pDM354 | Extrachromosomal expression vector. Gateway. G418 resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 534 | pDM358 | Extrachromosomal expression vector. MCS BglII/SpeI. Hygromycin resistance. | Douwe Veltman |
| 518 | pDM359 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Hygromycin resistance. | Douwe Veltman |
| 519 | pDM360 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Blasticidin resistance. | Douwe Veltman |
| 527 | pDM369 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Hygromycin resistance. N-terminal GFP tag. | Douwe Veltman |
| 528 | pDM370 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. MCS BglII/SpeI. Hygromycin resistance. C-terminal GFP tag. | Douwe Veltman |
| 529 | pDM371 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. Gateway. Hygromycin resistance. N-terminal GFP tag. | Douwe Veltman |
| 530 | pDM372 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. Gateway. Hygromycin resistance. C-terminal GFP tag. | Douwe Veltman |
| 531 | pDM373 | Extrachromosomal, inducible expression vector. Transactivator rtTA M2s*. Gateway. Hygromycin resistance. | Douwe Veltman |
| 556 | pDM410 | NgoMIV shuttle vector. Gateway. N-terminal GFP tag. | Douwe Veltman |
| 557 | pDM411 | NgoMIV shuttle vector. Gateway. N-terminal mRFPmars tag. | Douwe Veltman |
| 559 | pDM412 | NgoMIV shuttle vector. Gateway. C-terminal GFP tag. | Douwe Veltman |
| 558 | pDM413 | NgoMIV shuttle vector. Gateway. C-terminal mRFPmars tag. | Douwe Veltman |
| 560 | pDM414 | NgoMIV shuttle vector. Gateway. | Douwe Veltman |
| 547 | pDM448 | Extrachromosomal expression vector. Gateway. Hygromycin resistance. N-terminal GFP tag. | Douwe Veltman |
| 548 | pDM449 | Extrachromosomal expression vector. Gateway. Hygromycin resistance. N-terminal mRFPmars tag. | Douwe Veltman |
| 550 | pDM450 | Extrachromosomal expression vector. Gateway. Hygromycin resistance. C-terminal GFP tag. | Douwe Veltman |
| 549 | pDM451 | Extrachromosomal expression vector. Gateway. Hygromycin resistance. C-terminal mRFPmars tag. | Douwe Veltman |
| 113 | pDNeo2-Dd-TRAP1 | Dd-TRAP1 overexpression vector | Yasuo Maeda |
| 612 | pDneo2a | Wolfgang Nellen | |
| 624 | pDneo2a-3xFLAG | Wolfgang Nellen | |
| 615 | pDneo2a-3xHA | Wolfgang Nellen | |
| 617 | pDneo2a-3xHA-TAP | Wolfgang Nellen | |
| 600 | pDneo2a-6xMYC | ||
| 614 | pDneo2a-6xMyc | Wolfgang Nellen | |
| 618 | pDneo2a-6xMyc-TAP | Wolfgang Nellen | |
| 616 | pDneo2a-cTAP | Wolfgang Nellen | |
| 613 | pDneo2a-GFP | Wolfgang Nellen | |
| 619 | pDneo2a-GFP-TAP | Wolfgang Nellen | |
| 625 | pDneo2a-mRFP | Wolfgang Nellen | |
| 608 | pDneo2a-nTAP | Wolfgang Nellen | |
| 610 | pDneo2a-TAP-3xHA | Wolfgang Nellen | |
| 609 | pDneo2a-TAP-6xMyc | Wolfgang Nellen | |
| 611 | pDneo2a-TAP-GFP | Wolfgang Nellen | |
| 74 | pDNeo67 | Expression vector derived from pDNeoII by BAL31 digestion of the 4 methionine codons between the actin6 promoter and the mcs. The start codon has to be provided by the insert. | C. Klein? |
| 479 | pDNeo67-dia2-gfp | Vector expressing DIA2-GFP. | Aiko Amagai |
| 103 | pDNeoII (pDNeo2) | Expression vector including the start codon and first 8 amino acids of actin 6. | A. Noegel? |
| 464 | pDRH:GFP-tubulin | Ddp1-based expression vector for GFP-tubulin containing a hygromycin selection cassette. | Douglas Robinson |
| 465 | pDRH:RFP-tubulin | Ddp1-based expression vector for RFP-tubulin containing a hygromycin selection cassette. | Douglas Robinson |
| 463 | pDRHyg | Ddp1-based expression vector containing a hygromycin selection cassette. | Douglas Robinson |
| 320 | pdsB KO1234 | Pauline Schaap | |
| 319 | pdsB KO5234 | Pauline Schaap | |
| 233 | pDT1 | regA KO bsr. Insert blasticidin cassette into AHindIII332pKS (pDT4) as Xba fragment, then insert 3' homology as NotI/SacII PCR products. | Rob Kay |
| 235 | pDT12 | regA driven by actin 15 | Rob Kay |
| 234 | pDT5 (iplA-KO2) | iplA knockout construct | Rob Kay |
| 301 | pDU3B1 | DdPYR5-6 gene (3.7-kb genomic DNA in pBR322) | Jakob Franke |
| 325 | pDV-CGFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a C-terminal GFP tag. | Pauline Schaap |
| 326 | pDV-CGFP-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a C-terminal GFP and C-terminal TAP | Pauline Schaap |
| 243 | pDV-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a TAP tag at the C-terminus. | Pauline Schaap |
| 313 | pDV-CYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a YFP tag at the C-terminus. | Pauline Schaap |
| 329 | pDV-CYFP-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a C-terminal YFP and C-terminal TAP tag. | Pauline Schaap |
| 244 | pDV-NTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and a TAP tag at the N-terminus. | Pauline Schaap |
| 333 | pDV-NTAP-CGFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal TAP tag and C-terminal GFP. | Pauline Schaap |
| 335 | pDV-NTAP-CYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal TAP tag and C-terminal YFP | Pauline Schaap |
| 331 | pDV-NTAP-NYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and N-terminal TAP and YFP tags. | Pauline Schaap |
| 327 | pDV-NYFP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal YFP tag. | Pauline Schaap |
| 328 | pDV-NYFP-CTAP | Tandem affinity purification vector with expression under control of the actin 15 promoter, and an N-terminal YFP and C-terminal TAP tag. | Pauline Schaap |
| 63 | pDXA-3C | Expression vector under control of the actin 15 promoter and carrying a C-terminal c-myc tag. | Dietmar Manstein |
| 199 | pDXA-3FLAG | Dictyostelium expression vector with an N-terminal FLAG tag. | Dietmar Manstein |
| 198 | pDXA-3H | Expression vector under control of the actin 15 promoter and carrying a C-terminal histidine tag. | Dietmar Manstein |
| 336 | pDXA-3H-BL | pDXA-3H in which the G418-resistance cassette has been replaced with a blasticidin-resistance marker; note, this added a second Xho I restriction site into the vector, making this site unsuitable for cloning purposes. | Doug Robinson |
| 186 | pDXA-3H-Hygro | Dictyostelium expression vector derived from the vector pDXA-3H (6.1 kb), containing an hygromycin resistance cassette and a C-terminal histidine tag. | Dietmar Manstein |
| 95 | pDXA-CFP-MCS | Dictyostelium expression vector with an N-terminal CFP tag. | Dietmar Manstein |
| 109 | pDXA-FLAG | Dictyostelium expression vector based on Ddp2 (extrachromosomal in the presence of pREP) | Tom Egelhoff |
| 110 | pDXA-GFP2 | Dictyostelium expression vector based on Ddp2 (extrachromosomal in the presence of pREP) | Tom Egelhoff |
| 472 | pDXA-GFPABD120 | Vector expressing a fusion protein between GFP and the actin-binding domain of ABD120 (filamin). | David Knecht |
| 203 | pDXA-GST | Dictyostelium expression vector with an N-terminal GST tag and a C-terminal histidine tag. | Dietmar Manstein |
| 31 | pDXA-HC | Expression vector under control of the actin 15 promoter and carrying an N-terminal histidine tag and a C-terminal c-myc tag. Plasmid has been resequenced. | Dietmar Manstein |
| 96 | pDXA-HY | Dictyostelium expression vector with proteins expressed from the actin 15 promoter and providing an N-terminal 7-His tag and a C-terminal YL1/2-epitope tag. | Dietmar Manstein |
| 94 | pDXA-MCS-YFP | Dictyostelium expression vector with a C-terminal YFP tag. | Dietmar Manstein |
| 263 | pDXA-VatM-GFP | VatM-GFP fusion protein expression vector | Margaret Clarke |
| 201 | pDXA-YFP-MCS | Dictyostelium expression vector with an N-terminal YFP tag. | Dietmar Manstein |
| 585 | pDXA-YFP-MCS1-PKA-Fret | cAMP-binding domain B from the mammalian PKA RII β-subunit cloned between eCFP and eYFP in a Dictyostelium expression vector; FRET probe to detect cAMP in Dicty. The sequence and map are for the parental vector pDXA-YFP-MCS | Satarupa Das |
| 204 | pDXD-3C | Dictyostelium expression vector under control of the inducible discoidin Iγ promoter and carrying a C-terminal c-myc tag. | Dietmar Manstein |
| 205 | pDXD-3H | Dictyostelium expression vector under control of the inducible discoidin Iγ promoter and carrying a C-terminal histidine tag. | Dietmar Manstein |
| 580 | pEcm0-i-alpha-gal | ecm0 promoter driving labile gal in V18Tn5 backbone | Harry MacWilliams |
| 581 | pEcm0-i-alpha-gal & pEcm0-Ugus | ecm0 promoter driving labile gal and stable gus | Harry MacWilliams |
| 579 | pEcm0-labile-S65T-GFP | ligation of labile GFP into pst0p/V18Tn5 backbone | Harry MacWilliams |
| 277 | pEcmA-Rc | EcmA::PKA-Rsubunit (Rc mutant does bind C subunit = control) expression vector | Adrian Harwood |
| 278 | pEcmA-Rm | EcmA::PKA-Rsubunit (Rm mutant) expression vector | Adrian Harwood |
| 584 | pEcmA/GFP(S65T) | GFP(S65T) expressed under the control of the ecmA promoter | Danny Fuller (Loomis) |
| 577 | pEcmA0-i-alpha-gal | ecmA whole promoter driving iDQgal / V18Tn5 backbone | Harry MacWilliams |
| 578 | pEcmA0-i-alpha-gal & pEcmA0-Ugus | ecmA0 promoter (aka "63") driving labile gal and stable gus | Harry MacWilliams |
| 576 | pEcmA0-labile-S65T-GFP | ecmA promoter driving semilabile GFP in V18Tn5DRE | Harry MacWilliams |
| 50 | pEcmAO-Gal | Galactosidase fusion expression vector (prestalk marker) | Jeff Williams |
| 639 | pEcmAO-RFPmars | Susan Ross (Jeff Williams) | |
| 575 | pEcmB-i-alpha-gal | ligation of ecmBprom into iDQgal backbone | Harry MacWilliams |
| 638 | pEcmB-RFPmars | MARS-RFP fusion expression vector (pre-stalk marker) | Susan Ross (Jeff Williams) |
| 90 | pEgeA-GFP | GFP fused to the COOH-terminal of EgeA expression vector. | Peter Devreotes |
| 486 | pFL474 | apm2-knockout construct. PCR-amplified 3' and 5' regions of apm2 (mu2 or ?2), with a bsR cassette inserted in between, in pBluescript. | Francois Letourneur |
| 488 | pFL505 | Full-length apm1 (mu1 or µ1) expression construct in pDXA-3C. | Francois Letourneur |
| 484 | pFL603 | apm1-knockout construct. PCR amplified 3'- and 5'-regions of apm1 (mu1 or ?1), with bsR cassette inserted in between, in pBluescript. | Francois Letourneur |
| 489 | pFL619 | γ-Adaptin-GFP expression construct in pDXA-3C. | Francois Letourneur |
| 491 | pFL674 | CsA-Rh50 | Francois Letourneur |
| 490 | pFL712 | Full-length cDNA sequence coding for Phg2 was cloned into the pDXA-GFP2 expression vector. | Francois Letourneur |
| 242 | pflCAP-GFP | Full-length CAP cloned in frame with GFP in pDEX-T65S-GFP. | Angelika Noegel |
| 219 | pG3Neo-AmpA | Construct used to generate Ampa overexpressors and to rescue AmpA knockouts | Daphne Blumberg |
| 231 | pG3NeoI | Expression vector in which the expression of the neomycin phosphotransferase gene (Tn903) is driven by the actin 15 promoter. | Bill Loomis |
| 80 | pGACG | Insertion of fragment from pλ22 into pG1D at the common XbaI site. | Peter Devreotes |
| 284 | pGEG02-K | Rho GTPase (RacF2) knockout construct for KAX3 | Tetsuya Muramoto (Hideko Ursushihara) |
| 285 | pGEG02-V | Rho GTPase (RacF2) knockout construct for V12 | Tetsuya Muramoto (Hideko Ursushihara) |
| 193 | pGEG04-KAX3 | Hideko Urushihara | |
| 192 | pGEG04-V12 | Hideko Urushihara | |
| 190 | pGEG10 | Hideko Urushihara | |
| 561 | pGFP (1-21) | plasmid containing GFP tag for N-terminal fusion | Douwe Veltman |
| 18 | pGFP(S65T)-crtA | S65T-GFP-calreticulin in pDEXRH (G418) | Annette Muller-Taubenberger |
| 598 | pGFP-2FYVE | contains two copies of the FYVE domain from the human Hrs gene fused to the C-terminus of GFP in the Dictyostelium expression vector pTX-GFP; labels membranes enriched in phosphatidylinositol (3)-phosphate (early endosomes); parental vector: pTX-GFP | Margaret Clarke |
| 382 | pGFP-MHC-3xALA | Expresses "3xALA" mutant version of Dictyostelium mhcA with GFP fused at N-terminus, driven by actin 15 promoter. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 383 | pGFP-MHC-3xASP | Expresses "3xASP" mutant version of Dictyostelium mhcA with GFP fused at N-terminus, driven by actin 15 promoter. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 801 | pGFP-pgkA | The gene coding for PgkA (DDB_G0287595) was amplified by RT-PCR using RNA isolated from growing cells. The fragment was then cloned into the XhoI-XbaI sites of the vector pTX-GFP (kindly deposited in the DSC by Tom Egelhoff). | Ricardo Escalante |
| 803 | pGFP-Tkt | The gene coding for Tkt-1 (DDB_G0272618) was amplified by RT-PCR using RNA isolated from growing cells. The fragment was then cloned into the XhoI-XbaI sites of the vector pTX-GFP (kindly deposited at the DSC by Tom Egelhoff). | Ricardo Escalante |
| 493 | pGMET-Easy-srfB-bsr | Knockout plasmid for srfB using blasticidin selection. | Leandro Sastre |
| 79 | pGSP1 | Extrachromosomal ACG expression vector (coding sequence of ACG inserted in pJK1). | Peter Devreotes |
| 452 | pGSP10 | ACA fragment from pGSP9 inserted into the Dictyostelium extrachromosomal expression vector pATANB43. pGSP10 was used to generate aca-/ACA cells. | Carole Parent |
| 91 | pGSP2 | Plasmid containing genomic fragment of ACA. | Peter Devreotes |
| 449 | pGSP6 | Jane Borleis (Devreotes) | |
| 451 | pGSP9 | Full-length genomic construct of ACA containing about 1 kb of 5-prime untranslated sequence. | Carole Parent |
| 69 | PH-GFP (pWf38) | 700-bp N-terminal PH domain of CRAC fused to GFP, by cloning it into the GFP expression vector pb15rsGFP. This gives constitutive expression under the control of the actin 15 promoter. | Peter Devreotes |
| 721 | PH-PLCδ1-GFP | Used for live cell microscopy, labels membranes containing PI(4,5)P2. | Margaret Clarke |
| 602 | pHYG-tgrC1-KO | tgrC1 knock-out plasmid | Rocio Benabentos (Shaulsky Lab) |
| 453 | pHygTm(plus)/pG7 | Vector containing new hygromycin Bam cassette with cabA terminator. EcoR1 and BglII within Hyg were killed by mutagenesis. Made by Masashi Fukusawa (pers. commun. Jeff Williams, 5-8-08) | Susan Ross (Jeff Williams) |
| 305 | pi3k2-gfp | Reporter construct: pi3k2 ligated to GFP and expressed in EXP-4(+) | Jane Borleis |
| 375 | piaA-HSB1 | Mutated form of the piaA gene, containing the temperature-sensitive mutation, isolated from the mutant HSB1 and inserted into pBlueScript. | Salvo Bozzaro |
| 289 | piaAWT | Pianissimo expression vector used to rescue the HSB1 strain. Insert is most likely in pMyc86/6, but could also be in pBluescript. | Salvatore Bozzaro |
| 510 | pik4::bsr | Remi rescued plasmid from rasC-/pik4- cells (pikD knockout vector) | P. Bolourani (G. Weeks) |
| 720 | pIpkA1-OE | ipkA1 overexpression vector | Regina Teo (Adrian Harwood) |
| 719 | pItpk1-OE | itpk1 overexpression vector | Regina Teo (Adrian Harwood) |
| 349 | pJB1 | pyr5-6 gene (ClaI fragment of pDU3B1) in pBluescript. | Jane Borleis (Devreotes) |
| 350 | pJB22 | gufB (Gene of Unknown Function) | J. Franke/R. Kessin |
| 188 | pJH138 | Gα4-KO construct (Gα4::pyr5-6) | Jeff Hadwiger |
| 125 | pJH154 | BamHI genomic fragment (4.2 kb) containing the entire Gα4 gene (including promoter, terminator, etc.) cloned into BamHI site of pT3T718U (Pharmacia). A 2.2-kb EcoRI-BamHI neoR cassette from B10SX was inserted into EcoRI site. | Jeff Hadwiger |
| 126 | pJH161 | Gα4::lacZ fusion containing the promoter and first 17 codons of Gα4 gene. Inserted into pAT153L cloning vector. Also contains a neoR cassette (EcoRI fragment). | Jeff Hadwiger |
| 127 | pJH206 | XhoI-BclI genomic fragment (3.1 kb) containing entire Gα5 gene (including promoter, terminator, etc.) cloned into pT3T718U with added BclI site (Pharmacia). A 2.2kb EcoRI-BamHI neoR cassette from B10SX was inserted into EcoRI site. | Jeff Hadwiger |
| 128 | pJH210 | Gα5::lacZ fusion containing the promoter and first 14 codons of Gα5 gene. Inserted into pAT153L cloning vector. Also contains a neoR cassette (EcoRI fragment). | Jeff Hadwiger |
| 129 | pJH214 | PCR segment of the Gα5 gene that was later disrupted with the Thy1 gene to yield vector pJH216. | Jeff Hadwiger |
| 454 | pJH216 | Gα5 gene knockout construct (gα5::Thy1). Thy1 gene replaces a PstI-SpeI fragment in Gα5 genomic fragment. Excise gene disruption fragment with EcoRV-EcoRI digest. | Jeff Hadwiger |
| 456 | pJH280 | HindIII/KpnI frag from pUCBsrBam inserted into the same sites of pBluescript SK- (Stratagene). Many restriction sites available for excising Bsr gene. Reference for pUCBsrBam - Adachi H, Hasebe T, Yoshinaga K, Ohta T, Sutoh K. (1994) Isolation of Dictyostelium discoideum cytokinesis mutants by restriction enzyme-mediated integration of the blasticidin S resistance marker. Biochem Biophys Res Commun. 205:1808-14. | Jeff Hadwiger |
| 455 | pJH48 | Pyr5-6 gene with SalI linker inserted at PvuII site, can be excised with Asp718 and used to create pyr5-6- mutants (e.g., JH8) | Jeff Hadwiger |
| 21 | pJK1 | Extrachromosal vector containing a neoR cassette derived from the Ddp1-based vector pATANB43 (Pmid 2813371) into which the actin15 promoter and the 2H3 terminator have been inserted. | Peter Devreotes |
| 22 | pJK3 | cAR1 cDNA cloned in the extrachromosomal expression vector pJK1 | Peter Devreotes |
| 388 | pJR1 | Karl Saxe | |
| 445 | pJRC119 | GFP-Set1 rescue construct (in pDEXH82). | Jonathan Chubb |
| 444 | pJRC13 | Set1 bsr disruption plasmid | Jonathan Chubb |
| 347 | pJRC36 | dscA MS2-tagging vector | Jonathan Chubb |
| 348 | pJRC76 | MS2-GFP expression vector | Jonathan Chubb |
| 446 | pJRC88 | GFP-Set1:C147A construct (in pDEXH82) | Jonathan Chubb |
| 447 | pJRC89 | GFP-Set1:N142Q construct (in pDEXH82). | Jonathan Chubb |
| 458 | pJSK19 | Myc-tagged Dictyostelium replacement Arp2 expressed in pRHI76. | Mehreen Zaki (Rob Insall) |
| 245 | pKK4 | Tandem affinty purification (TAP) vector. | Katrin Koch (R. Graf) |
| 450 | pKL2 | ACA fragment from pGSP9 inserted in the Dictyostelium expression vector pB18. pKL2 was used to generate aca-/ACAact-15 cells. | Carole Parent |
| 485 | pLAI7 | apm4-knockout construct. PCR-amplified 3' and 5' regions of apm4 (mu4 or µ4), with a bsR cassette inserted in between, in pBluescript. | Francois Letourneur |
| 441 | pLAS103 | Plasmid rescued with EcoRI from cheater mutant LAS103. Remi insertion in gene DDB_G0280089 (unknown function). | Elizabeth Villegas (Gad Shaulsky) |
| 419 | pLAS18 | Plasmid rescued with EcoRI from cheater mutant LAS18. Non-intragenic REMI insertion near rab7B (Rab GTPase). | Elizabeth Villegas (Gad Shaulsky) |
| 420 | pLAS19 | Plasmid rescued with EcoRI from cheater mutant LAS19. Remi insertion in pks26 (putative polyketide synthase; beta-ketoacyl synthase family protein). | Elizabeth Villegas (Gad Shaulsky) |
| 421 | pLAS26 | Plasmid rescued with BglII from cheater mutant LAS26. Remi insertion in DDB_G0277239 (Non-receptor tyrosine kinase spore lysis A (EC 2.7.1.112) (Tyrosine-protein kinase 1). | Elizabeth Villegas (Gad Shaulsky) |
| 422 | pLAS27 | Plasmid rescued with BglII from cheater mutant LAS27. Non-intragenic remi insertion near DDB_G0280203. | Elizabeth Villegas (Gad Shaulsky) |
| 423 | pLAS29 | Plasmid rescued with BglII from cheater mutant LAS29. Remi insertion in DDB_G0273201 (DNA-binding HORMA domain-containing protein; mitotic spindle assembly checkpoint protein). | Elizabeth Villegas (Gad Shaulsky) |
| 408 | pLAS3 | Plasmid rescued with EcoR1 from cheater mutant LAS3 (DDB0187308; putative ubiquitin-conjugating enzyme E2). | Elizabeth Villegas (Gad Shaulsky) |
| 424 | pLAS31 | Plasmid rescued with BglII from cheater mutant LAS31. Remi insertion in pikG (phosphatidylinositol 3-kinase; PI3kinase). | Elizabeth Villegas (Gad Shaulsky) |
| 425 | pLAS32 | Plasmid rescued with BglII from cheater mutant LAS32. Remi insertion in docA (timA, DG1012, DG2016). SH3 domain-containing protein; DOCK family protein; putative guanine nucleotide exchange factor (GEF). Similar to H. sapiens DOCK180 protein. | Elizabeth Villegas (Gad Shaulsky) |
| 426 | pLAS34 | Plasmid rescued with BglII from cheater mutant LAS34. Remi insertion in DDB_G0278585 (unknown function). | Elizabeth Villegas (Gad Shaulsky) |
| 427 | pLAS38 | Plasmid rescued with BglII from cheater mutant LAS38. Non-intragenic REMI insertion (DDB0202322, DDB0202324). | Elizabeth Villegas (Gad Shaulsky) |
| 428 | pLAS39 | Plasmid rescued with BglII from cheater mutant LAS39. Remi insertion in DDB_G0292148 (Arf GTPase activating protein). | Elizabeth Villegas (Gad Shaulsky) |
| 429 | pLAS43 | Plasmid rescued with SpeI from cheater mutant LAS43. Remi insertion in DDB_G0274431 (hypothetical 127.0 kDa protein). | Elizabeth Villegas (Gad Shaulsky) |
| 430 | pLAS44 | Plasmid rescued with SpeI from cheater mutant LAS44. Remi insertion in pks2- (putative polyketide synthase; beta-ketoacyl synthase family protein). | Elizabeth Villegas (Gad Shaulsky) |
| 431 | pLAS49 | Plasmid rescued with BglII from cheater mutant LAS49. Non-intragenic remi insertion near genes DDB_G0273325 and DDB_G0273271. | Elizabeth Villegas (Gad Shaulsky) |
| 415 | pLAS5 | Plasmid rescued with EcoRI from cheater mutant LAS5. GeneDDB0191519 (rsc6) REMI mutant; similar to heat shock protein Hsp20 domain-containing protein; but does not contain a Hsp20 domain | Elizabeth Villegas (Gad Shaulsky) |
| 432 | pLAS51 | Plasmid rescued with BglII from cheater mutant LAS51. Non-intragenic REMI insertion near gene DDB_G0285547 (unknown function). | Elizabeth Villegas (Gad Shaulsky) |
| 434 | pLAS53 | Plasmid rescued with EcoRI from cheater mutant LAS53. Remi insertion in abkD (putative protein serine/threonine kinase; ABC1 family protein kinase; ABC1-B subfamily protein kinase). Contains ABC1 kinase (protein kinase-like) domain; yeast ABC1 essential for the electron transfer in the BC(1) complex; E.coli homolog required for ubiquinone biosynthesis). | Elizabeth Villegas (Gad Shaulsky) |
| 433 | pLAS54 | Plasmid rescued with EcoRI from cheater mutant LAS54. Remi insertion in gene DDB_G0280299 (unkown function). | Elizabeth Villegas (Gad Shaulsky) |
| 435 | pLAS57 | Plasmid rescued with EcoRI from cheater mutant LAS57. Non-intragenic remi insertion between genes DDB_G0268864 and DDB_G0268866 (unknown functions). | Elizabeth Villegas (Gad Shaulsky) |
| 436 | pLAS58 | Plasmid rescued with EcoRI from cheater mutant LAS58. Non-intragenic remi insertion between DDB_G0284973 and tpsB (glycosyltransferase α,α-trehalose-phosphate synthase trehalose 6-phosphate synthase trehalose-phosphatase) | Elizabeth Villegas (Gad Shaulsky) |
| 416 | pLAS6 | Plasmid rescued with EcoRI from cheater mutant LAS6. Remi insertion between genes DDB0203824 (DDB_G0276383) and DDB0201646 (pyr1-3). | Elizabeth Villegas (Gad Shaulsky) |
| 437 | pLAS60 | Plasmid rescued with ClaI from cheater mutant LAS60. Non-intragenic remi insertion between genes DDB_G0285935 and helD (DEAD/DEAH box helicase; putative RNA splicing factor). Conserved RNA helicase; S. cerevisiae prp16 involved in the second catalytic step of splicing, exhibits ATP-dependent RNA unwinding activity. | Elizabeth Villegas (Gad Shaulsky) |
| 417 | pLAS7 | Plasmid rescued with EcoRI from cheater mutant LAS7. Remi insertion in DDB_G0290685 (unknown gene product; highly repetitive protein: contains close to 100 repeats of the sequences DGENNQ, DGGENNQ, or very related sequences) | Elizabeth Villegas (Gad Shaulsky) |
| 438 | pLAS70 | Plasmid rescued with ClaI from cheater mutant LAS70. Remi insertion in DDB_G0279405 (putative protein serine/threonine kinase; CAMKK family protein kinase; Meta subfamily protein kinase). | Elizabeth Villegas (Gad Shaulsky) |
| 418 | pLAS8 | Plasmid rescued with EcoRI from cheater mutant LAS8. Remi insertion in . Similar to Oryza sativa (Japonica cultivar-group). Putative zinc transporter protein ZIP1. | Elizabeth Villegas (Gad Shaulsky) |
| 439 | pLAS91 | Plasmid rescued with EcoRI from cheater mutant LAS91. Remi insertion in abcC9 (ABC transporter C family protein). | Elizabeth Villegas (Gad Shaulsky) |
| 440 | pLAS99 | Plasmid rescued with EcoRI from cheater mutant LAS99. Remi insertion in dhkE (histidine kinase; protein kinase, atypical group; HisK family protein kinase). | Elizabeth Villegas (Gad Shaulsky) |
| 310 | pLD1A15SN | Modified pLD1 vector which contains the Ddp2-based origin of replication. The Robinson expression libray is available from the stock center. | Doug Robinson |
| 298 | pLD1A15SN:dynhp | Expression vector for dynacortin hairpin construct. | Doug Robinson |
| 466 | pLD1A15SN:fimbrin RNAi | Expression vector for fimbrin RNAi hairpin | Doug Robinson |
| 467 | pLD1A15SN:GFP-fimbrin | Expression vector for GFP-fimbrin | Doug Robinson |
| 297 | pLD1A15SN:GFPdynacortin | Doug Robinson | |
| 309 | pLD1A15SN:myoIIhp | Expression vector for myosin II hairpin construct. | Doug Robinson |
| 122 | pLittle | Autonomous replicating extrachromosomal expression vector with G418 cassette, derived from pBIG by the removal of a 1.3-kb KpnI fragment. | Tom Egelhoff |
| 589 | pLoxNeoI | contains G418 cassette and loxP sequence; parent: pUC19 | Yoshinori Kawabe (Pauline Schaap) |
| 590 | pLoxNeoII | contains G418 cassette and loxP sequence; parent: pUC19 | Yoshinori Kawabe (Pauline Schaap) |
| 9 | pLPBLP | Plasmid containing floxed-Bsr cassette for generating multiple gene disruptions. | Jan Faix |
| 475 | pMars-LimE-delta-coil | RFPmars-limE-delta-coil fusion plasmid containing a blasticidin resistance marker; LimE-delta-coil cloned into the EcoRI site of plasmid 339-3 (mRFPmars in pBsrH) | David Knecht (Annette Mueller-Taubenberger) |
| 44 | pMB35 | Transactivator plasmid containing the tTAs* gene under the control of A15P and 2H3T . | Mieke Blaauw (Peter van Haastert) |
| 45 | pMB38 | Extrachromosomal response plasmid containing the inducible promoter TRE-Pmin upstream of the 2H3T terminator with 4 unique restriction sites in between. | Mieke Blaauw (Peter van Haastert) |
| 392 | pMBP-Aur | Full-length DdAurora cDNA cloned in bacterial vector pMal-c2X (NEB) for protein purification in E. coli. N-terminal MBP tag; ampR. | Arturo De Lozanne |
| 19 | pMC25 | cAR1 gene disruption construct (ura selection): 2-kb region immediately upstream of cAR1 coding region and 0.4-kb 3'coding region plus 0.1-kb 3'non-translated region subloned into pBluescript-SK. 3.7-kb ClaI fragment from pDU3B1 was subloned between the fragments. | Peter Devreotes |
| 20 | pMC34 | cAR1 cDNA minus first 2 codons, (nt 97-1312), cloned into the BglII site of pJK1 | Peter Devreotes |
| 71 | pMC36 | cAR1 cDNA in the BglII site of pJK1 | Peter Devreotes |
| 661 | pMidA-KO | Mid A KO vector; dicty resistance marker is blasticidin; bacterial resistance marker is Ampicillin; parental vector is pGEMt from PROMEGA | Ricardo Escalante |
| 102 | pMKC-Hyg1 | myosin heavy chain knockout vector containing hygromycin resistance cassette | Tom Egelhoff |
| 77 | pMYC-86-6 | Vector expressing the piaAWT gene (full-length piaA cDNA). See d6652, PhD Thesis of M.Y. Chen. | Peter Devreotes |
| 75 | pMYC4 | Plasmid for generating Gα1/Gα2 chimeras (backbone is pBluescript KS-). | Peter Devreotes |
| 76 | pMYC5 | Plasmid for generating Gα2/Gα1 chimeras (backbone is pBluescript KS-). | Peter Devreotes |
| 323 | pmycELC | ELC (essential myosin light chain) cDNA tagged with a 30-base myc sequence at the 3'end, introduced in expression vector pBORP. | Rex Chisholm |
| 240 | pN-CAP-Pro-GFP | N-terminal domain of CAP (containing the proline-rich region) cloned in frame with GFP in pDdA15gfp. | Angelika Noegel |
| 54 | pPatB-KO | patB (P-type H+-ATPase) gene disruption construct. | Barrie Coukell |
| 92 | pPIA-HIS-GFP | A PiaA-eGFP expression vector containing a 2x proline linker and the hexyl histidine sequence. A full desription can be found on page 135 of the PhD thesis of J. Silverman (2004). | Peter Devreotes |
| 804 | pPK6 | acaA was tagged at the c-terminal end with YFP using a sph-1 linker. This construct was used for over-expressing ACA-YFP for fluorescent microscopy. | Paul Kriebel / Carole Parent |
| 222 | pPL3/lacZ | PL3 promoter-lacZ fusion construct (PL3 is prespore gene pspD encoding spore coat protein SP87) | Daphne Blumberg |
| 241 | pPro-C-CAP-GFP | C-terminal domain of CAP (containing the proline-rich region) cloned in frame with GFP in pDdA15gfp. | Angelika Noegel |
| 354 | pPROF120 | Apoaequorin expression plasmid derived from pDNeo2. | Paul Fisher |
| 207 | pPROF128 | HspA (chaperonin 60) antisense construct in pDNeo2. | Paul Fisher |
| 596 | pPRX-GFP | expresses a fusion of GFP to the peroxisomal targeting sequence Ser-Lys-Leu-COOH, under the control of the actin-15 promoter. This plasmid brightly labels peroxisomes in Dictyostelium cells; based on pPRX?GFP | Margaret Clarke |
| 573 | pPsA-i-alpha-gal | psA promoter driving labile gal in V18Tn5DRE | Harry MacWilliams |
| 574 | pPsA-i-alpha-gal & pPSA-Ugus | psA promoter driving labile gal and stable gus | Harry MacWilliams |
| 572 | pPSA-labile-S65T-GFP | psA promoter driving short-lived GFP, in V18Tn5 backbone | Harry MacWilliams |
| 276 | pPsA-Rc | PsA::PKA-Rsubunit (Rc mutant does bind C subunit = control) expression vector | Adrian Harwood |
| 275 | pPsA-Rm | PsA::PKA-Rsubunit (Rm mutant) expression vector. | Adrian Harwood |
| 358 | pPT130 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 359 | pPT131 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 360 | pPT132 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 361 | pPT134 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 362 | pPT135 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 363 | pPT165 | Gateway vector (expression vector for recombination cloning). | Peter Thomason (Ted Cox) |
| 236 | pPT17 | D212N mutant regA "rescue" vector. | Rob Kay |
| 237 | pPT39 | GST-rdeA H63Q expression vector | Rob Kay |
| 238 | pPT40 | GST-rdeA H65Q expression vector (inactive mutant) | Rob Kay |
| 66 | pPTEN-GFP | The PTEN cDNA was cloned upstream of the start codon of the GFP gene. The resulting PTEN-GFP construct was inserted downstrean of the actin 15 promoter in the extrachromosomal vector pJK1. | Peter Devreotes |
| 67 | pPTEN-KO | pten KO vector | Peter Devreotes |
| 791 | pPyr56-KO | Used to KO pyr56 gene (DDB_G0280041). Bacterial selection: amp; dicty selection: none (5FOA); parent pMfeI-tRNA (ochre) | Rocio Benabentos |
| 795 | pQS31-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS31 and tgrC1-QS31 alleles, driven by QS31 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos |
| 800 | pQS31-tgrB1/tgrC1-bsR | tgrB1/tgrC1 Merodiploid plasmid with tgrB1-QS31 and tgrC1-QS31 alleles, driven by QS31 promoter. Used to insert an extra set of tgrB1/tgrC1 alleles randomly in the genome. Bacterial selection: amp; dicty selection: bsR; parent pGEM3 | Rocio Benabentos |
| 796 | pQS38-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS38 and tgrC1-QS38 alleles, driven by QS38 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos |
| 794 | pQS4-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS4 and tgrC1-QS4 alleles, driven by QS4 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos |
| 799 | pQS4-tgrB1/tgrC1-bsR | tgrB1/tgrC1 Merodiploid plasmid with tgrB1-QS4 and tgrC1-QS4 alleles, driven by QS4 promoter. Used to insert an extra set of tgrB1/tgrC1 alleles randomly in the genome. Bacterial selection: amp; dicty selection: bsR; parent pGEM3 | Rocio Benabentos |
| 797 | pQS45-tgrB1/tgrC1 | tgrB1/tgrC1 double gene replacement plasmid with tgrB1-QS45 and tgrC1-QS45 alleles, driven by QS45 promoter. Used to insert these alleles into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none (5FOA); parent pGEM3 | Rocio Benabentos |
| 287 | pRacF2-G12V | Rho GTPase (RacF2) overexpression vector (constitutive active) | Tetsuya Muramoto (Hideko Ursushihara) |
| 288 | pRacF2-N17T | Rho GTPase (RacF2) overexpression vector (dominant negative). | Tetsuya Muramoto (Hideko Ursushihara) |
| 286 | pRacF2-WT | Rho GTPase (RacF2) overexpression vector | Tetsuya Muramoto (Hideko Ursushihara) |
| 587 | pRccA | plasmid to create rccA knock out mutant; parent plasmid: pBSR1 | Anupama Khare (Gad Shaulsky's lab) |
| 5 | pREMI:GFP-1 | REMI plasmid (neoR) for gene trapping, with GFP that can only be expressed from host promoter. | Petra Fey (Ted Cox) |
| 6 | pREMI:GFP-2 | REMI plasmid (neoR) for gene trapping, with GFP that can only be expressed from host promoter. | Petra Fey (Ted Cox) |
| 7 | pREMI:GFP-3 | REMI plasmid (neoR) for gene trapping, with GFP that can only be expressed from host promoter. | Petra Fey (Ted Cox) |
| 12 | pREP | Plasmid for cotransformation with pDXA/DXD series expression vectors. Pedigree: neoR cassette from pnDedeltaI removed by cutting with SacI/BamHI. | Menno Knetsch (Dietmar Manstein) |
| 802 | pRFP-GFP-Atg8 | The construct RFP-GFP-Atg8 was generated using GFP-Atg8 fragment amplified by PCR from the vector pA15/GFP-Apg8 (kindly deposited at the DSC by Grant OTTO). This fragment was then cloned in frame using XhoI site at the C terminus of the RFP protein from the vector pTX-RFPmars (kindly deposited at the DSC by Clement Nizak). | Ricardo Escalante |
| 303 | pRHI25 | Remi plasmid with truncated pyr5-6. Similar to pRHI30 but some of the PCR'd sequence was removed from the clone. | Rob Insall |
| 27 | pRHI30 | Plasmid containing a truncated pyr5-6 region. | Peter Devreotes |
| 84 | pRHI38 | Vector expressing the CRACWT gene. CRAC cDNA cloned into pRHI8, an expression vector derived from pATANB43 (pers. communic. R. Insall, 5/27/08). | Peter Devreotes |
| 353 | pRHI71 | RasGefA (aimless) in pRHI8, which is a Ddp1-based extrachromosomal vector. | Rob Insall |
| 457 | pRHI76 | Extrachromosomal expression vector. Aequorin inserted as BglII-NotI fragment between the constitutive actin15 promoter and the 2H3 terminator of pRHI8. | Mehreen Zaki (Rob Insall) |
| 459 | pRHI8 | Extrachromosomal expression vector. The BglII and NotI sites are too close to one another so it cuts badly. Use pRHI76 instead. | |
| 30 | pRJ525 | cAR3 in pBlueScript | Peter Devreotes |
| 83 | pRJ544 (5car3neo) | cAR3 knockout construct | Peter Devreotes |
| 82 | pRJ648 (5cAR3ura) | cAR3-KO vector | Peter Devreotes |
| 116 | pRNR-P | regulated expression vector based on the DNA-damage inducibility of the rnrB gene (ribonucleotide reductase promoter) | Adrian Tsang |
| 478 | pRNR-zyg1 | Inducible expression vector for overexpression of the zyg1 gene. | Aiko Amagai |
| 181 | PSA/idq-galΔ5 | Harry MacWilliams (through Herb Ennis) | |
| 308 | pSadA-GFP | C-terminal GFP fusion | Petra Fey (Chisholm) |
| 49 | pspA-Gal (D19-Gal) | Construct drives the expression of beta-galactosidase as fusion protein containing the first five amino acids of PsA, under the control of a prespore promoter. | Jeff Williams |
| 345 | pspA/myc-fbxA | Myc-tagged FbxA under the control of the prespore pspA promoter, in a pDXA background. | Jakob Franke |
| 603 | pTagB-BsR | REMI rescue construct from a tagB insertion mutant (insertion at position 2672 of the tagB coding region). Linearize with ClaI to use for homologous recombination | Anupama Khare (Gad Shaulsky) |
| 582 | pTagB/GFP(S65T) | GFP(S65T) expressed under the control of the tagB promoter | Danny Fuller (Loomis) |
| 606 | pTagB/lacZ | Dictyostelium expression vector, expressing lacZ under the tagB promoter. | Anupama Khare (Gad Shaulsky) |
| 390 | pTAP-Aur | Full-length DdAurora gDNA cloned in TAPGFP-tag vector for protein expression and purification in Dictyostelium. N-terminal TAPGFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 391 | pTAP-Aur-KD | Expression construct for expressing kinase inactive form of TAPGFP-DdAurora(K139R) in Dictyostelium. N-terminal TAPGFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 396 | pTAP-INCENP | Full-length DdINCENP cDNA cloned in TAPGFP-tag vector for protein expression and purification in Dictyostelium. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 397 | pTAP-INCENP-Δcs1 | The first 500 amino acids of DdINCENP cloned in TAPGFP-tag vector for protein expression and purification in Dictyostelium. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 591 | pTasAloxP-KO | plasmid for knocking out tasA in Polysphondylium pallidum; parent: pLoxNeoI (DSC: 589) | |
| 599 | pTasB:Gal | This vector contains lacZ driven by TasB promoter | Yoshinore Kawabe (Pauline Schaap) |
| 593 | pTasBexp | Vector for expression of TasB under its own promoter | Yoshinore Kawabe (Pauline Schaap) |
| 592 | pTasBloxP-KO | plasmid for knocking out tasB in Polysphondylium pallidum; parent: pLoxNeoI (DSC: 589) | |
| 307 | pten-KO-hyg | PTEN-knockout vector with hygromycin cassette. | Jane Borleis (Devreotes) |
| 403 | pTF169Cla | Plasmid popped out of DG1108 (acaA- remi mutant). The insertion in the gene was at the DpnII site at bp2575 relative to the ATG, with the T7 of BamHI-cut pBSR1 reading towards the 3-prime end of the gene. | Danny Fuller (Bill Loomis) |
| 404 | pTF169Eco | Plasmid popped out of DG1108 (acaA- remi mutant) with EcoRI. The insertion in the gene was at the DpnII site at bp2575 relative to the ATG, with the T7 of BamHI-cut pBSR1 reading towards the 3-prime end of the gene. | Danny Fuller (Bill Loomis) |
| 483 | pTF70-HindIII | Popout vector from the Remi mutant DG1047 (Cytochrome-P450 oxidoreductase - redA - knockout vector). Remi plasmid was pBSR3. | Danny Fuller (Loomis) |
| 778 | pTgrB1-hyg | Used to KO tgrB1 (DDB_G0280689). Bacterial selection: amp; dicty selection: hygR; parent pLPBLP | Rocio Benabentos |
| 779 | pTgrB1/AX4:DEST- bsR | Destination vector (Invitrogen system) to insert any allele into the tgrB1 single gene replacement system, which would insert this allele into tgrB1 locus. Bacterial selection: amp and chloramphenicol; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 780 | pTgrB1/AX4:tgrB1/AX4-bsR | tgrB1 single gene replacement plasmid with tgrB1-AX4 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 782 | pTgrB1/AX4:tgrB1/QS31-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS31 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 783 | pTgrB1/AX4:tgrB1/QS38-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS38 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 784 | pTgrB1/AX4:tgrB1/QS45-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS45 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 781 | pTgrB1/AX4]:tgrB1/QS4-bsR | tgrB1 single gene replacement plasmid with tgrB1-QS4 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 792 | pTgrB1/tgrC1-KO-pyr56+ | Used to KO tgrB1 (DDB_G0280689) and tgrC1 (DDB_G0280531) and insert a pyr56 gene (DDB_G02800041) into the tgrB1/tgrC1 locus. Bacterial selection: amp; dicty selection: none; parent pRHI13 | Rocio Benabentos |
| 786 | pTgrC1/AX4:tgrC1AX4-bsR | tgrC1 single gene replacement plasmid with tgrC1-AX4 allele. Bacterial selection: amp; dicty selection: bsR; parent Plpblp | Rocio Benabentos |
| 788 | pTgrC1/AX4:tgrC1QS31-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS31 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 789 | pTgrC1/AX4:tgrC1QS38-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS38 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 787 | pTgrC1/AX4:tgrC1QS4-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS4 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 790 | pTgrC1/AX4:tgrC1QS45-bsR | tgrC1 single gene replacement plasmid with tgrC1-QS45 allele. Bacterial selection: amp; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 785 | pTgrC1/AX4]:DEST- bsR | Destination vector (Invitrogen system) to insert any allele into the tgrC1 single gene replacement system, which would insert this allele into tgrC1 locus. Bacterial selection: amp and chloromphenicol; dicty selection: bsR; parent pLPBLP | Rocio Benabentos |
| 123 | pTIKL | Autonomous replicating extrachromosomal expression vector with G418 cassette. Same as pLittle but with 2 NcoI sites in the neoR cassette removed with site-directed muagenesis. | Tom Egelhoff |
| 378 | pTIKL-MyD | Expresses full-length mhcA fused to actin15 promoter. MHC fragment from pMyD was excised as xbaI-SacI fragment and ligated into pTIKL. Made by Taro Uyeda. Use G418 selection for Dicty, ampicillin for bacteria. | Tom Egelhoff |
| 597 | pTopA-GFP | fusion of GFP to the first 35 amino acids of Dictyostelium DNA topoisomerase II (topA, aka top2mt), which targets the GFP to mitochondria; brightly labels mitochondria in Dictyostelium cells; construct made in pDXA-3H | Margaret Clarke |
| 26 | pTorA-B18 | TorA expression vector | Peter Devreotes |
| 189 | pTorA-GFP-B18 | Expression vector with GFP-labeled TorA (in the integrating vector pB18). | Peter Devreotes |
| 65 | pTorA-KO | TorA KO vector (in SP73) | Peter Devreotes |
| 220 | pTVKO4 | Construct used to generate ampA null mutant | Daphne Blumberg |
| 393 | pTX-Aur | Full-length DdAurora gDNA cloned in pTX-GFP for examination of subcellular localization of DdAurora. N-terminal GFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 394 | pTX-Aur-KD | Expression construct for expressing kinase inactive form of GFP-DdAurora. The ATP-binding site Lysine139 was replaced by Arginine (Terada et al., 1998; Pmid: 9450992). N-terminal GFP tag; neoR. (by Hui Li) | Arturo De Lozanne |
| 377 | pTX-ecmA-YFP | YFP from citrine was amplified by PCR and cloned into the pTX vector after removal of the actin 15 promoter and insertion of the ecmA promoter. | Clement Nizak |
| 111 | pTX-FLAG | Dictyostelium extrachromosomal expression vector based on Ddp1 | Tom Egelhoff |
| 211 | pTX-FLAG-vwk | FLAG-labeled vwk (vWFA kinase) expression vector | Tom Egelhoff |
| 11 | pTX-GFP | GFP expression under control of the actin15 promoter (extrachromosomal vector based on Ddp1) | Tom Egelhoff |
| 210 | pTX-GFP-vwk | GFP-labeled vwk (vWFA kinase) expression vector | Tom Egelhoff |
| 399 | pTX-INCENP | Full-length DdINCENP (icpA) cDNA cloned in pTX-GFP for examination of subcellular localization of GFP-DdINCENP. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 401 | pTX-INCENP-ΔC | The first 1013 amino acids of DdINCENP, not including the IN-domain, cloned in pTX-GFP for the examination of the subcelluar localization of GFP-DdINCENP1-1013. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 398 | pTX-INCENP-Δcs1 | The first 500 amino acids of DdINCENP cloned in pTX-GFP for the subcelluar localization of GFP-DdINCENP1-500. N-terminal GFp tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 402 | pTX-INCENP-Δcs2 | The first 273 amino acids of DdINCENP cloned in pTX-GFP for the examination of the subcelluar localization of GFP-DdINCENP1-273. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 400 | pTX-INCENP-ΔN | The last 833 amino acids of DdINCENP, including the IN-box, cloned in pTX-GFP for the examination of the subcelluar localization of GFP-DdINCENP488-1320. N-terminal GFP tag; neoR. (by Qian Chen) | Arturo De Lozanne |
| 634 | pTX-MKA1 | carries GFP fused to N-terminus of MHCKA, with actin 15 promoter | Tom Egelhoff |
| 636 | pTX-MKA2 | FLAG fusion at N-terminus of MHCKA, with actin 15 promoter | Tom Egelhoff |
| 632 | pTX-MKB1 | carries GFP fused to N-terminus of MHCKB, with actin 15 promoter | Tom Egelhoff |
| 637 | pTX-MKB2 | FLAG fusion at N-terminus of MHCKB, with actin 15 promoter | Tom Egelhoff |
| 633 | pTX-MKC1 | carries GFP at N-terminus of MHCKC, with actin 15 promoter | Tom Egelhoff |
| 635 | pTX-MKC2 | FLAG fusion at N-terminus of MHCKC with actin 15 promoter | Tom Egelhoff |
| 376 | pTX-PsA-CFP | ECFP from Clontech was amplified by PCR and cloned into the pTX vector after removal of the actin 15 promoter and insertion of the PsA promoter. | Clement Nizak |
| 112 | pTX-RFPmars | Dictyostelium extrachromosomal expression vector based on Ddp1. Cells are bright red. The RFP is derived from 339-3: mRFPmars in pBsrH (ID# 1). GFP of pTX-GFP was replaced with RFPmars of plasmid 339-3: RFP fragment of 339-3 obtained by cutting with BglII (blunted with Klenow) and BamHI. Inserted into pTX-GFP digested with SalI (blunted with Klenow) and BamHI. | Clement Nizak |
| 395 | pTX-TAPGFP | TAPGFP-tag vector for protein expression and purification in Dictyostelium. A TAP tag was inserted was inserted to the N-terminal of GFP in pTX-GFP. | Arturo De Lozanne |
| 41 | pUCBsrΔBam | REMI plasmid | G. Shaulsky |
| 100 | pUNK-KO | MHCK B knockout vector with bsR cassette | Tom Egelhoff |
| 52 | pV18-bsr | V18 promoter driving BsR in pUC118 backbone. V18 promoter was amplified by PCR with downstream primer containing N-terminus of BsR up to Bgl2 site. PCR product was cloned in PBS SK- yielding pV18BsRN (no. 267). Removed again with Bgl2/Xba1 digestion and cloned into Bgl2/Xba1 restricted A15BsR (no. 134). | |
| 206 | pV18-I-S65T-GFP | V18 promoter driving ubi-I-s65tgfp in V18Tn5turbo background | Harry MacWilliams (via Stefan Pukatzki) |
| 571 | pV18-labile-luc | labile luciferase gene under control of the V18 (rpl11) promoter | Harry MacWilliams |
| 209 | pV18-VSon1-FLAG | Flag-tagged SonA cDNA | Jakob Franke (Stefan Pukatzki) |
| 262 | pVATM-act6 | Vector for vatM promoter replacement. | Margaret Clarke |
| 118 | pVEII | inducible gene expression vector containing the discoidin gamma promoter; constructed by replacing the act6 promoter in pDnNeo2. Transformation vector which can be used for expression of genes from the discoidin I gamma promoter. The vector contains a multiple cloning site for inserting the gene of interest. The discoidin ATG is located upstream of the MCS. We recommend sequencing the junction of the insert using a primer within the promoter. The oligo: 5'-GAA AAA TTA AAA TTT CAT ACA AAT TAT C-3' worked well for us; you can start reading at the ATG - XbaI site. Regulation of the promoter is described in Vauti et al., Mol. Cell. BioI. 8, 4080-4088, 1990. The paper by Blusch et al., Nucl. Acids Res. 20, 6235-6238, 1992 describes use of pVEII as an inducible expression system. This has now been working for several people (e.g. M. Clarke, G. Weeks). In addition, Dictyostelium cells with altered discoidin expression can be used to get higher or lower expression. These mutant strains can be obtained from B. Wetterauer and H. MacWilliams (PMID 8464730 and PMID 8396055). | Wolfgang Nellen |
| 261 | pVMop | G418-selectable transformation vector containing vatM driven by its own promoter. | Margaret Clarke |
| 60 | pVS | Expression vector with discoidin promoter (growing cells) for secretory proteins. G418 selectable. BglII and BamHI sites upstream of and downstream from a c-myc tag. | Chris West |
| 477 | pVS-Hyg | Expression vector with discoidin promoter (growing cells) for secretory proteins. Hygromycin selectable. BglII and BamHI sites upstream of and downstream from a c-myc tag. The SalI fragment (hygR cassette) from pDHGFP was cloned into the XhoI site of pVS4 (pVS clone 4). NruI and AfeI were used to remove most of the neoR cassette (personal commun. Chris West). | Chris West |
| 61 | pVSC | Expression vector with cotB promoter (prespore cells) for secretory proteins. G418 selectable. BglII and BamHI sites upstream of, and downstream from, a c-myc tag. | Chris West |
| 476 | pVSE | Expression vector with ecmA promoter (prestalk cells) for secretory proteins. G418 selectable. BglII and BamHI sites upstream of, and downstream from, a c-myc tag. Vector is derived from pSV4 by replacement of the discoidin promoter with the ecmA promoter. | Chris West |
| 443 | pVTL-AL | Dictyostelium reporter plasmid containing the AP-endonuclease (apeA) upstream sequence in front of the luciferase gene is inducible with bleomycin (DNA-damaging agent). | Rob Guyer (Deering) |
| 387 | pVTL2 | Autonomously propagating luciferase-encoding vector. | R. Guyer (R.A. Deering) (C. Rutherford) |
| 212 | pVWKA-KO1 | vwkA kockout vector | Tom Egelhoff |
| 78 | pYL23 | piaA knockout construct, made by replacing 0.4-kb EcoRI-HindIII fragment of the coding region with a vector carrying the URA selectable marker. | Peter Devreotes |
| 448 | pYL44 | piaA knockout vector made by Yu Long. EcoRI-XbaI 1.4-kb bsr cassette from pJH280 ligated with pYL23digested with ecoRI and XbaI (4.4 kb). | Jane Borleis (Devreotes) |
| 260 | Rap1 | Rap1 overexpression vector (in pVEII) | Gerry Weeks |
| 256 | Rap1-G12V | Mutated Rap1 overexpression vector (based on pVEII) | Gerry Weeks |
| 255 | Rap1-S17N | Mutated Rap1 overexpression vector (based on pVEII) | Gerry Weeks |
| 512 | rasC rescue plasmid | rasC cDNA with rasC promoter plus G418 cassette for rasC-ko rescue. | P. Bolourani (G. Weeks) |
| 250 | RasC-bsr | Knockout vector for RasC | Gerry Weeks |
| 251 | RasC-thy | Knockout vector for RasC | Gerry Weeks |
| 509 | rasC::bsr (pJLW26) | Knockout vector for rasC | P. Bolourani (G. Weeks) |
| 515 | rasC::[GFP/rasC] | GFP-rasC expression construct under control of the rasC promoter. | P. Bolourani (G. Weeks) |
| 252 | RasG | RasG (wild type) overexpression vector (based on pVEII) | Gerry Weeks |
| 513 | rasG rescue plasmid | rasG genomic DNA plus G418 cassette for rasG-ko rescue. | P. Bolourani (G. Weeks) |
| 253 | RasG-G12T | Mutated RasG overexpression vector (based on pVEII) | Gerry Weeks |
| 254 | RasG-S17N | Mutated RasG overexpression vector (based on pVEII) | Gerry Weeks |
| 507 | rasG::bsr | Knockout vector for rasG | P. Bolourani (G. Weeks) |
| 508 | rasG::thy1 | Knockout vector for rasG | P. Bolourani (G. Weeks) |
| 364 | RasGEFM-KO vector | RasGefM knockout vector | Salvo Bozzaro |
| 494 | RFP-Syntaxin7 | RFP-BamHI-Syntaxin7-stop-EcoRI (in pBsrH-RFPmars) An EcoRI site was introduced in the sequence by the silent A777G mutation. Decorates endocytic compartments and sometimes the contractile vacuole bladders. | Nelly Bennett |
| 496 | RFP-Syntaxin8 | RFP-BamHI-Syntaxin8-stop-EcoRI (in pBsrH-mRFPmars) Decorates the bladders and tubular network of the contractile vacuole. | Nelly Bennett |
| 495 | RFP-Vti1 | RFP-BamHI-Vti1-stop-EcoRI (in pBsrH-mRFPmars) Decorates the bladders and tubular network of the contractile vacuole. | Nelly Bennett |
| 249 | RIP3-KO | RIP3 knockout vector | Rick Firtel |
| 248 | RIP3-OE | RIP3 overexpression vector | Rick Firtel |
| 215 | rps4AS | Antisense construct for the mitochondial ribosomal protein S4 (RPS4) | Junji Chida (Yasuo Maeda) |
| 216 | rps4OE | Overexpression construct for the mitochondial ribosomal protein S4 (RPS4) | Junji Chida (Yasuo Maeda) |
| 58 | Scar-KO construct (p9A/O7C11) | Scar-KO construct (Scar-::Blast), isolated as suppressor of carB-null | Karl Saxe |
| 318 | sGCKO3486 | Pauline Schaap | |
| 3 | SL405 | PAKc KO construct. The BamHI blasticidin cassette was inserted in the BglII site created at position 560 of the PAKc cDNA, and a SpeI-XhoI fragment was ligated into pBluescript-SK. | Rick Firtel |
| 2 | SL515 | PAKb (mihck) KO construct. cDNA fragment 970-2057 was amplified, digested with XhoI (introduced) and EcoRI, and ligated in pBluescript-SK. The blasticidin cassette was inserted in the BamHI site at nt 1686. | Rick Firtel |
| 4 | SL516 | PAKb (mihck) KO construct for double null mutant. The BamHI hygromycin cassette was inserted in the BamHI site at position 1686 of the PAKb cDNA, and an EcoRI-XhoI fragment was ligated into pBluescript-SK. | Rick Firtel |
| 214 | SMEK OE | SMEK overexpression construct | Rick Firtel |
| 213 | smkA-KO | smkA knockout construct | Rick Firtel |
| 97 | srfA-KO | srfA knockout vector | Leandro Sastre |
| 115 | TRAP1-RNAi MB38 | Dd-TRAP1 knockdown vector utilizing the tetracycline-regulated gene expression system (tet-off system) described by Blaauw et al., 2000 (pmid 10903439). | Yasuo Maeda |
| 53 | V/63-Gal | ||
| 180 | V/63-I-S65T | emcA promoter driving semilabile GFP in V18TnDRE. The gfp has a protein half life of around 4 hours. The promoter is the entire original ecmA promoter and ultimately comes from 63-neo-gal (Jeff Williams). Constructed by Bgl2/XhoI shotgun from V/63-idq-gal in V18tn5 (no. 323) and Psa-I-s65tgfp in Sk- (no. 177). | Harry MacWilliams (through Herb Ennis) |
| 184 | V/63-idq-gal | Harry MacWilliams (through Herb Ennis) | |
| 179 | V/A15-GFP | Harry MacWilliams (through Herb Ennis) | |
| 182 | V/A6-gal | Harry MacWilliams (through Herb Ennis) | |
| 183 | V/PSA-gal | Harry MacWilliams (through Herb Ennis) | |
| 178 | V/PsA-I-S65T-GFP | Ligation of PsA-I-S65T and V18Tn5DRE. Constructed by Xba1/Xho1 shotgun starting from PsA-I-S65Tgfp in A6Tn5 (no. 190 and 63-ugus in V18Tn5DRE (no. 344). | Harry MacWilliams (through Herb Ennis) |
| 324 | V63gal | ||
| 481 | VA6 | The expression vector VA6 was made by ligation of the XbaI-HindIII fragment of pDNeo2 (containing the actin 6 promoter and MCS) with the pRNR-P vector from which the the rnrB promoter was removed by digestion with XbaI and HindIII. | Aiko Amagai |
| 480 | VA6aco | Vector containing the actin 6 promoter upstream of the Dd-aco cDNA and the V18 promoter upstream of the neoR gene (Tn5). | Aiko Amagai |
| 482 | VA6aco RNAi | Dd-aco knockdown vector. | Aiko Amagai |
| 500 | VAMP7-GFP | BamHI-VAMP7-XhoI-GFP-NsiI-myc-stop (in pDXD-3C) | Nelly Bennett |
| 72 | YakA-GFP | GFP was fused to the C terminus of YakA, which was truncated by deleting the 190 C-terminal amino acids. | Peter Devreotes |
| 88 | YakA-KO | YakA knockout vector (8-kb religated BglII fragment of genomic DNA from REMI mutant, containing the plasmid pBSR3?) . | Peter Devreotes |
| Home| Contact dictyBase| Contact Dicty Stock Center Curators| SOPs| Site Map |
Supported by NIH (NIGMS and NHGRI)
|
